Permalink
Cannot retrieve contributors at this time
CenterStringLP/center_string.py
Go to file| ''' | |
| PROBLEM STATEMENT | |
| The closest sequence problem is defined as follows: | |
| Given m DNA sequences s1, . . . , sm, each of length n, find a DNA sequence t of length | |
| n such that maxi=1,...,m dH(t, si) is minimized, where dH(t, si) denotes the Hamming distance | |
| between t and si. | |
| For this project you must implement a method for finding optimum solutions to the closest sequence | |
| problem. You can either implement a branch-and-bound algorithm or use integer programming in | |
| conjunction with optimization engines such as the GNU Linear Programming Kit (GLPK). | |
| INPUT | |
| Your program should read from the standard input a line containing integers m and n, followed by | |
| m lines each containing a DNA sequence of length n. | |
| Sample input: | |
| 10 25 | |
| CTGGCGGTGGCTATCATCCGTCCCT | |
| CATGCGAGTGGTCGGTGATAGCTCG | |
| GAAGTGTGAGGAATCCGTAGAGAAT | |
| GAACTAAGTAGTTCACCTTACCCTC | |
| CCAACACTCATATCGTCTTGCTACT | |
| TGACTCCTTTTTTATTCATATTTTC | |
| AATACTCGACCTTCCACGAAGGCTG | |
| GGATTCACCTCCCTTTCCGCTGAAT | |
| CAGAGGTAAAAGAAAGGGGGACAAT | |
| GATAATCGTAGAATTAAATAAGACA | |
| OUTPUT | |
| If you use integer programming, your program should print to the standard output an integer program | |
| model of the input problem instance in lp format (see http://lpsolve.sourceforge.net/5.1/CPLEXformat.htm). | |
| ''' | |
| # Imports | |
| import os | |
| import sys | |
| # I need to symlink my Anaconda install with this :/ | |
| sys.path.append('/usr/local/lib/python2.7/dist-packages') | |
| import cplex | |
| # Absolute path to inputs, outputs | |
| path_to_inputs = '/home/moria/Projects/Bioinformatics/CenterStringLP/Inputs/' | |
| path_to_outputs = '/home/moria/Projects/Bioinformatics/CenterStringLP/Outputs/' | |
| # Master bases | |
| bases = ['A','C','T','G'] | |
| # For each input file... | |
| for fn in os.listdir(path_to_inputs): | |
| # Split filename into prefix, suffix | |
| pre,suff = fn.split('.') | |
| # Reset line counter, init array S to store sequences | |
| line_num = 0 | |
| S = [] | |
| # Open the files | |
| f_in = open(path_to_inputs+fn, 'r') | |
| f_out = open(path_to_outputs+pre+'.lp', 'w') | |
| # For each line in the input file... | |
| for line in f_in: | |
| # If line num is 0, grab n,m else put stripped sequence into S | |
| if line_num == 0: | |
| # get number of strings, length of strings | |
| m,n = line.split(' ') | |
| m = int(m) | |
| n = int(n) | |
| line_num += 1 | |
| else: | |
| S.append(str(line.strip())) | |
| line_num += 1 | |
| # Write LP | |
| # We want to minimize d subject to constraints | |
| f_out.write('Minimize\n') | |
| f_out.write(' obj: d\n') | |
| f_out.write('Subject To\n') | |
| count = 0 # Constraint counter | |
| # For each sequence in S | |
| for s in S: | |
| # Write first part - c#: | |
| equation = ' ' | |
| equation += 'c' + str(count) + ': ' | |
| count += 1 | |
| # For each index, value in sequence s | |
| for i,v in enumerate(s): | |
| equation += ' - ' + str(v) + str(i) | |
| equation += ' - d <= - ' + str(n) + '\n' | |
| f_out.write(equation) | |
| # All Xi's must add up to 1 | |
| for number in range(n): | |
| constraint = ' c' + str(count) + ': ' | |
| count += 1 | |
| for letter in bases: | |
| constraint += ' + ' + letter + str(number) | |
| constraint += ' = 1\n' | |
| f_out.write(constraint) | |
| # No bounds, just binary numbers | |
| f_out.write('Bounds\n') | |
| f_out.write('Binaries\n') | |
| for number in range(n): | |
| for letter in bases: | |
| f_out.write(' '+ letter + str(number)) | |
| f_out.write('\n') | |
| f_out.write('End') | |
| f_in.close() | |
| f_out.close() | |
| # Solve the problem, output solution | |
| lp_problem = cplex.Cplex() | |
| print 'Solving ' + pre + '.lp\n' | |
| lp_problem.read(path_to_outputs+pre+'.lp') | |
| lp_problem.solve() | |
| soln = '' | |
| # If Xi = 1, append it to the solution as this is the center string in element i | |
| for number in range(n): | |
| for letter in bases: | |
| if lp_problem.solution.get_values(letter+str(number)) == 1: | |
| soln += letter | |
| print "\n\nCenter string is: " + soln + "\n" | |
| print "d is " + str(lp_problem.solution.get_values('d')) + "\n\n\n\n###################" |